Transcript: Mouse XM_006527308.2

PREDICTED: Mus musculus SWI5 dependent recombination repair 1 (Sfr1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfr1 (67788)
Length:
1544
CDS:
105..1028

Additional Resources:

NCBI RefSeq record:
XM_006527308.2
NBCI Gene record:
Sfr1 (67788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429434 CTGAGTTAGAGAATCTAATAA pLKO_005 844 CDS 100% 15.000 21.000 N Sfr1 n/a
2 TRCN0000190529 GCTATACACTTGGCCCATTTA pLKO.1 1113 3UTR 100% 13.200 18.480 N Sfr1 n/a
3 TRCN0000201285 GCCCATTTACAGATTGTCTTT pLKO.1 1125 3UTR 100% 4.950 6.930 N Sfr1 n/a
4 TRCN0000190847 GTGAATCTAAGTCGTCGGATA pLKO.1 664 CDS 100% 4.050 5.670 N Sfr1 n/a
5 TRCN0000417565 TATAAGACGAAGCTTAGTATT pLKO_005 1252 3UTR 100% 13.200 10.560 N Sfr1 n/a
6 TRCN0000191964 GAGGTTAAAGTTAGTCAAGAT pLKO.1 800 CDS 100% 4.950 3.960 N Sfr1 n/a
7 TRCN0000414992 AGTCTGAGAATGCGATCATTA pLKO_005 712 CDS 100% 13.200 9.240 N Sfr1 n/a
8 TRCN0000200631 CCAGGGTTAATTCATTGATTT pLKO.1 1355 3UTR 100% 13.200 9.240 N Sfr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.