Transcript: Mouse XM_006527355.1

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily c, polypeptide 55 (Cyp2c55), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2c55 (72082)
Length:
1325
CDS:
109..1308

Additional Resources:

NCBI RefSeq record:
XM_006527355.1
NBCI Gene record:
Cyp2c55 (72082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173964 GCAGAGATCGATCACGTGATT pLKO.1 1081 CDS 100% 4.950 6.930 N Cyp2c55 n/a
2 TRCN0000219590 TGGCCACTGTAACCGACATAT pLKO.1 971 CDS 100% 13.200 9.240 N Cyp2c55 n/a
3 TRCN0000174664 GAAACCACAAACATTACTCTA pLKO.1 1006 CDS 100% 4.950 3.465 N Cyp2c55 n/a
4 TRCN0000194021 GAGTGAAAGAACACCAGGAAA pLKO.1 848 CDS 100% 4.950 3.465 N Cyp2c55 n/a
5 TRCN0000193770 CCATGGTACATGAGATTCAGA pLKO.1 1157 CDS 100% 3.000 2.100 N Cyp2c55 n/a
6 TRCN0000174372 CCCTTTCCCAATTATTGGAAA pLKO.1 210 CDS 100% 0.495 0.347 N Cyp2c55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.