Transcript: Mouse XM_006527398.3

PREDICTED: Mus musculus centrosomal protein 55 (Cep55), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep55 (74107)
Length:
2680
CDS:
366..1754

Additional Resources:

NCBI RefSeq record:
XM_006527398.3
NBCI Gene record:
Cep55 (74107)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183083 CGTTTAGAACTCGATGAATTT pLKO.1 1137 CDS 100% 13.200 18.480 N Cep55 n/a
2 TRCN0000366894 CCGTGACTCAGTTGCGTTTAG pLKO_005 1123 CDS 100% 10.800 15.120 N Cep55 n/a
3 TRCN0000375942 CCTGCTTGTCCATGTCGAATA pLKO_005 1721 CDS 100% 10.800 15.120 N Cep55 n/a
4 TRCN0000375943 CTGTTGTAATGACTAGCATTT pLKO_005 2013 3UTR 100% 10.800 8.640 N Cep55 n/a
5 TRCN0000375877 AGAGGTCGGAGGAGCTCTTAT pLKO_005 1330 CDS 100% 13.200 9.240 N Cep55 n/a
6 TRCN0000366948 CAGCGAGAGGCCTACGTTAAA pLKO_005 933 CDS 100% 13.200 9.240 N Cep55 n/a
7 TRCN0000366947 GACCACCTAAGGTCAAGATAT pLKO_005 630 CDS 100% 13.200 9.240 N Cep55 n/a
8 TRCN0000366878 ATATGCAGCATCAACTCTATG pLKO_005 1477 CDS 100% 10.800 7.560 N Cep55 n/a
9 TRCN0000182908 CAGCATCAACTCTATGTGATT pLKO.1 1482 CDS 100% 4.950 3.465 N Cep55 n/a
10 TRCN0000183560 GAAGATTGAATCAGAAGGTTA pLKO.1 1028 CDS 100% 4.950 3.465 N Cep55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.