Transcript: Mouse XM_006527413.1

PREDICTED: Mus musculus RAB3A interacting protein (rabin3)-like 1 (Rab3il1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab3il1 (74760)
Length:
2826
CDS:
516..1904

Additional Resources:

NCBI RefSeq record:
XM_006527413.1
NBCI Gene record:
Rab3il1 (74760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110148 CTTCTTCACCTATATTCGCTA pLKO.1 1772 CDS 100% 2.640 3.696 N Rab3il1 n/a
2 TRCN0000110146 GCCCACTGTTGAGTGTAACAA pLKO.1 1628 CDS 100% 5.625 4.500 N Rab3il1 n/a
3 TRCN0000140658 CCTGTTTGAGGAAGCTCACAA pLKO.1 959 CDS 100% 4.950 3.465 N RAB3IL1 n/a
4 TRCN0000110149 GAGCTGAAGCTAAAGGATGAA pLKO.1 873 CDS 100% 4.950 3.465 N Rab3il1 n/a
5 TRCN0000110147 GTATGCAACTTCTTCACCTAT pLKO.1 1764 CDS 100% 4.950 3.465 N Rab3il1 n/a
6 TRCN0000140631 GAGGAAGCTCACAAGATGGTT pLKO.1 966 CDS 100% 3.000 1.500 Y RAB3IL1 n/a
7 TRCN0000140875 GTTCTGGGAGATCATGAGGTT pLKO.1 1832 CDS 100% 2.640 1.848 N RAB3IL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.