Transcript: Mouse XM_006527422.1

PREDICTED: Mus musculus coiled-coil domain containing 172 (Ccdc172), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc172 (75645)
Length:
1241
CDS:
98..1051

Additional Resources:

NCBI RefSeq record:
XM_006527422.1
NBCI Gene record:
Ccdc172 (75645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202042 CGAGATGGAAATGGCTGACTT pLKO.1 745 CDS 100% 4.950 3.960 N Ccdc172 n/a
2 TRCN0000201801 GAGACAGCTCAGTGAGATTAT pLKO.1 577 CDS 100% 13.200 9.240 N Ccdc172 n/a
3 TRCN0000189751 GAGCTGATCTCTACGTGAACA pLKO.1 1085 3UTR 100% 4.950 3.465 N Ccdc172 n/a
4 TRCN0000202397 GATTACCAGATGTCGTGGGAA pLKO.1 436 CDS 100% 2.640 1.848 N Ccdc172 n/a
5 TRCN0000189750 GCTCAGTGAGATTATCAGCGA pLKO.1 583 CDS 100% 0.660 0.462 N Ccdc172 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.