Transcript: Mouse XM_006527600.3

PREDICTED: Mus musculus lysine (K)-specific demethylase 6A (Kdm6a), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kdm6a (22289)
Length:
5849
CDS:
643..4713

Additional Resources:

NCBI RefSeq record:
XM_006527600.3
NBCI Gene record:
Kdm6a (22289)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527600.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096240 CCGAGCAAACAGAAATAATTT pLKO.1 1947 CDS 100% 15.000 21.000 N Kdm6a n/a
2 TRCN0000305237 TGGACTTGCAGCACGAATTAA pLKO_005 1812 CDS 100% 15.000 21.000 N Kdm6a n/a
3 TRCN0000305239 AGTTAGCAGTGGAACGTTATG pLKO_005 4256 CDS 100% 10.800 15.120 N Kdm6a n/a
4 TRCN0000107762 GCAGCACGAATTAAGTATTTA pLKO.1 1819 CDS 100% 15.000 10.500 N KDM6A n/a
5 TRCN0000096241 CCAGCTCATTATTGTAGTATT pLKO.1 4486 CDS 100% 13.200 9.240 N Kdm6a n/a
6 TRCN0000096242 GCTACGAATCTCTAATCTTAA pLKO.1 884 CDS 100% 13.200 9.240 N Kdm6a n/a
7 TRCN0000331919 GCTACGAATCTCTAATCTTAA pLKO_005 884 CDS 100% 13.200 9.240 N Kdm6a n/a
8 TRCN0000311277 CTATGCCAGGACTCTCGTAAA pLKO_005 4882 3UTR 100% 10.800 7.560 N Kdm6a n/a
9 TRCN0000096239 GATTGCACATAGACTAAGAAA pLKO.1 5310 3UTR 100% 5.625 3.938 N Kdm6a n/a
10 TRCN0000096243 CCTTCTCCTAAGTCCACTGAA pLKO.1 2989 CDS 100% 4.950 3.465 N Kdm6a n/a
11 TRCN0000218870 CTGGAATATGGCACGAAATAT pLKO_005 4329 CDS 100% 15.000 9.000 N UTY n/a
12 TRCN0000305301 GCATTTCAGTGGGCTATTAAA pLKO_005 1081 CDS 100% 15.000 9.000 N Kdm6a n/a
13 TRCN0000107763 GATGCAAGTCTATGACCAATT pLKO.1 4656 CDS 100% 10.800 6.480 N KDM6A n/a
14 TRCN0000107764 GCATGAACACAGTTCAACTAT pLKO.1 3890 CDS 100% 5.625 3.375 N KDM6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527600.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.