Transcript: Mouse XM_006528053.3

PREDICTED: Mus musculus TATA-box binding protein associated factor 1 (Taf1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Taf1 (270627)
Length:
5977
CDS:
90..5642

Additional Resources:

NCBI RefSeq record:
XM_006528053.3
NBCI Gene record:
Taf1 (270627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363052 CAAGCAGCTTCTTCGTAAATT pLKO_005 3161 CDS 100% 15.000 21.000 N Taf1 n/a
2 TRCN0000079050 CGGGCACATGAGGACAAATAA pLKO.1 3962 CDS 100% 15.000 21.000 N Taf1 n/a
3 TRCN0000362988 TTCTATCTTGGAGTCTATTAT pLKO_005 4310 CDS 100% 15.000 21.000 N Taf1 n/a
4 TRCN0000363050 TTCGAGAATTAGTGGATATTT pLKO_005 2470 CDS 100% 15.000 12.000 N Taf1 n/a
5 TRCN0000195160 CCACTGTTCACTGTGACTATT pLKO.1 4231 CDS 100% 13.200 9.240 N TAF1 n/a
6 TRCN0000280315 CCACTGTTCACTGTGACTATT pLKO_005 4231 CDS 100% 13.200 9.240 N TAF1 n/a
7 TRCN0000079052 GCCAACAGTGTTAAGTACAAT pLKO.1 4881 CDS 100% 5.625 3.938 N Taf1 n/a
8 TRCN0000079049 GCTGGGATTATGCAGCATGAT pLKO.1 786 CDS 100% 4.950 3.465 N Taf1 n/a
9 TRCN0000079051 CCCTGGTAAATGATGAAGGAT pLKO.1 367 CDS 100% 3.000 2.100 N Taf1 n/a
10 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 5709 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.