Transcript: Mouse XM_006528096.2

PREDICTED: Mus musculus ATPase, class VI, type 11C (Atp11c), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp11c (320940)
Length:
3631
CDS:
189..3506

Additional Resources:

NCBI RefSeq record:
XM_006528096.2
NBCI Gene record:
Atp11c (320940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101854 CCTGAGATTCTCCTAATAGTT pLKO.1 3426 CDS 100% 5.625 7.875 N Atp11c n/a
2 TRCN0000101853 CGTAAGAAGTTGCTGCATGAA pLKO.1 2355 CDS 100% 4.950 6.930 N Atp11c n/a
3 TRCN0000101852 GCTTTGAACTACCAAGGGAAA pLKO.1 999 CDS 100% 4.050 5.670 N Atp11c n/a
4 TRCN0000449216 TTCTGGAACAGAACCTTATAT pLKO_005 275 CDS 100% 15.000 10.500 N Atp11c n/a
5 TRCN0000101850 CCAGGGTACATAGCCATCAAA pLKO.1 1900 CDS 100% 5.625 3.938 N Atp11c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.