Transcript: Mouse XM_006528336.2

PREDICTED: Mus musculus LAS1-like (S. cerevisiae) (Las1l), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Las1l (76130)
Length:
2732
CDS:
122..2365

Additional Resources:

NCBI RefSeq record:
XM_006528336.2
NBCI Gene record:
Las1l (76130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247934 CTGCGAGTCTGTTCCATTTAT pLKO_005 1574 CDS 100% 15.000 21.000 N Las1l n/a
2 TRCN0000247932 GGGAGCAAGTGACGGTTTATC pLKO_005 228 CDS 100% 13.200 18.480 N Las1l n/a
3 TRCN0000183008 CGTGAAATTATTGCCGATGAT pLKO.1 716 CDS 100% 4.950 6.930 N Las1l n/a
4 TRCN0000257773 AGTATGCGCTGAACCGAATTA pLKO_005 276 CDS 100% 13.200 10.560 N Las1l n/a
5 TRCN0000215893 CATTTGCTTCAGGCTATTAAA pLKO.1 938 CDS 100% 15.000 10.500 N Las1l n/a
6 TRCN0000247933 CATTTGCTTCAGGCTATTAAA pLKO_005 938 CDS 100% 15.000 10.500 N Las1l n/a
7 TRCN0000178828 CGAGAATTGCTGGTATCCTAT pLKO.1 881 CDS 100% 4.950 3.465 N Las1l n/a
8 TRCN0000122148 GATGAACTTAGACTGCTCTAT pLKO.1 401 CDS 100% 4.950 3.465 N LAS1L n/a
9 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1830 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528336.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.