Transcript: Mouse XM_006528538.2

PREDICTED: Mus musculus killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (Kir3dl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kir3dl2 (245615)
Length:
2100
CDS:
127..1272

Additional Resources:

NCBI RefSeq record:
XM_006528538.2
NBCI Gene record:
Kir3dl2 (245615)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067008 CAATAAACAGACAGCTTTCTA pLKO.1 1251 CDS 100% 5.625 3.938 N Kir3dl2 n/a
2 TRCN0000067009 TGCACAGAAGAAGATCCCAAA pLKO.1 1072 CDS 100% 4.050 2.835 N Kir3dl2 n/a
3 TRCN0000067011 GCATTCTAACTGGGCTCTTAA pLKO.1 1115 CDS 100% 13.200 7.920 N Kir3dl2 n/a
4 TRCN0000067012 CCTTTCCTCTTGATTCTACAA pLKO.1 469 CDS 100% 4.950 2.475 Y Kir3dl2 n/a
5 TRCN0000066961 GCACATAGTGAGCCTCTGAAA pLKO.1 421 CDS 100% 4.950 2.475 Y Kir3dl1 n/a
6 TRCN0000067010 GCTAATGTATTGTCAGCACAT pLKO.1 406 CDS 100% 4.050 2.025 Y Kir3dl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.