Transcript: Mouse XM_006528758.3

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class A (Piga), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Piga (18700)
Length:
3319
CDS:
790..1299

Additional Resources:

NCBI RefSeq record:
XM_006528758.3
NBCI Gene record:
Piga (18700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311227 ATAGGACCTGCACCCATAATA pLKO_005 301 5UTR 100% 15.000 21.000 N Piga n/a
2 TRCN0000222631 CCCATGCTTATGGAAATCGAA pLKO.1 430 5UTR 100% 3.000 4.200 N Piga n/a
3 TRCN0000077121 CCAGACTCTTTCATTGATGTT pLKO.1 1183 CDS 100% 4.950 3.960 N Piga n/a
4 TRCN0000077118 GCCAAATGTTTCTGGATTGTT pLKO.1 1599 3UTR 100% 5.625 3.938 N Piga n/a
5 TRCN0000302928 GCCAAATGTTTCTGGATTGTT pLKO_005 1599 3UTR 100% 5.625 3.938 N Piga n/a
6 TRCN0000083347 CCATGCTTATGGAAATCGAAA pLKO.1 431 5UTR 100% 4.950 3.465 N PIGA n/a
7 TRCN0000077119 CGGGAAAGATACCAACTACAT pLKO.1 667 5UTR 100% 4.950 3.465 N Piga n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.