Transcript: Mouse XM_006528840.2

PREDICTED: Mus musculus structural maintenance of chromosomes 1A (Smc1a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smc1a (24061)
Length:
3598
CDS:
138..3437

Additional Resources:

NCBI RefSeq record:
XM_006528840.2
NBCI Gene record:
Smc1a (24061)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109033 GCAGGCATTTGAACAGATAAA pLKO.1 2903 CDS 100% 13.200 10.560 N Smc1a n/a
2 TRCN0000324673 GCAGGCATTTGAACAGATAAA pLKO_005 2903 CDS 100% 13.200 10.560 N Smc1a n/a
3 TRCN0000062554 CGACAGATTATCGGACCATTT pLKO.1 89 5UTR 100% 10.800 8.640 N SMC1A n/a
4 TRCN0000299515 CGACAGATTATCGGACCATTT pLKO_005 89 5UTR 100% 10.800 8.640 N SMC1A n/a
5 TRCN0000109031 CCAGAGAACATCCAGTATCTA pLKO.1 2633 CDS 100% 5.625 4.500 N Smc1a n/a
6 TRCN0000324736 CCAGAGAACATCCAGTATCTA pLKO_005 2633 CDS 100% 5.625 4.500 N Smc1a n/a
7 TRCN0000109030 ACTCTATCTTCTTGTCTGGAT pLKO.1 3443 3UTR 100% 2.640 2.112 N Smc1a n/a
8 TRCN0000324672 ACTCTATCTTCTTGTCTGGAT pLKO_005 3443 3UTR 100% 2.640 2.112 N Smc1a n/a
9 TRCN0000062557 CCAACATTGATGAGATCTATA pLKO.1 2971 CDS 100% 13.200 9.240 N SMC1A n/a
10 TRCN0000299517 CCAACATTGATGAGATCTATA pLKO_005 2971 CDS 100% 13.200 9.240 N SMC1A n/a
11 TRCN0000109032 GCGTCGTATTGATGAGATCAA pLKO.1 1136 CDS 100% 4.950 3.465 N Smc1a n/a
12 TRCN0000109034 GCTTCAAATGCGGCTGAAGTA pLKO.1 1856 CDS 100% 0.495 0.347 N Smc1a n/a
13 TRCN0000324674 GCTTCAAATGCGGCTGAAGTA pLKO_005 1856 CDS 100% 0.495 0.347 N Smc1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.