Transcript: Mouse XM_006529075.2

PREDICTED: Mus musculus high density lipoprotein (HDL) binding protein (Hdlbp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hdlbp (110611)
Length:
4459
CDS:
242..4048

Additional Resources:

NCBI RefSeq record:
XM_006529075.2
NBCI Gene record:
Hdlbp (110611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105174 CGGAGCCAACATCAACAGAAT pLKO.1 1603 CDS 100% 4.950 6.930 N Hdlbp n/a
2 TRCN0000325803 CGGAGCCAACATCAACAGAAT pLKO_005 1603 CDS 100% 4.950 6.930 N Hdlbp n/a
3 TRCN0000154197 CCATCGCTTTGTTATTGGCAA pLKO.1 724 CDS 100% 2.640 3.696 N HDLBP n/a
4 TRCN0000306050 ATGGTCAAAGACCTGATTAAT pLKO_005 1520 CDS 100% 15.000 10.500 N Hdlbp n/a
5 TRCN0000306116 GCAGCTGGACCCTCGTAAATT pLKO_005 4120 3UTR 100% 15.000 10.500 N Hdlbp n/a
6 TRCN0000105171 GCTCGCATTAAGAAGATTTAT pLKO.1 1085 CDS 100% 15.000 10.500 N Hdlbp n/a
7 TRCN0000325804 GCTCGCATTAAGAAGATTTAT pLKO_005 1085 CDS 100% 15.000 10.500 N Hdlbp n/a
8 TRCN0000105172 CCAGAGGTTATCATCAACTTT pLKO.1 1853 CDS 100% 5.625 3.938 N Hdlbp n/a
9 TRCN0000325879 CCAGAGGTTATCATCAACTTT pLKO_005 1853 CDS 100% 5.625 3.938 N Hdlbp n/a
10 TRCN0000105173 CCTTAAATTCAGAAGAGGAAA pLKO.1 324 CDS 100% 4.950 3.465 N Hdlbp n/a
11 TRCN0000154928 GCCAAGCCAGAATACCACAAA pLKO.1 2441 CDS 100% 4.950 3.465 N HDLBP n/a
12 TRCN0000292469 GCCAAGCCAGAATACCACAAA pLKO_005 2441 CDS 100% 4.950 3.465 N HDLBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.