Transcript: Mouse XM_006529082.3

PREDICTED: Mus musculus alkaline phosphatase, placental-like 2 (Alppl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Alppl2 (11650)
Length:
2016
CDS:
74..1663

Additional Resources:

NCBI RefSeq record:
XM_006529082.3
NBCI Gene record:
Alppl2 (11650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081449 CCTGGTTACAAGCTCCATAAT pLKO.1 1316 CDS 100% 13.200 10.560 N Alppl2 n/a
2 TRCN0000081448 GCCTCCTTCATCTGGTACTTT pLKO.1 1804 3UTR 100% 5.625 3.938 N Alppl2 n/a
3 TRCN0000081452 CTTTGAGCCTAACGACATGAA pLKO.1 931 CDS 100% 4.950 3.465 N Alppl2 n/a
4 TRCN0000081450 CATCAGCTAAGAACCTCGTTA pLKO.1 219 CDS 100% 4.950 2.970 N Alppl2 n/a
5 TRCN0000081451 GCTGAGGATGGCAAATCCTTT pLKO.1 1271 CDS 100% 0.495 0.297 N Alppl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.