Transcript: Mouse XM_006529147.2

PREDICTED: Mus musculus 5-hydroxytryptamine (serotonin) receptor 2B (Htr2b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Htr2b (15559)
Length:
6017
CDS:
2781..4220

Additional Resources:

NCBI RefSeq record:
XM_006529147.2
NBCI Gene record:
Htr2b (15559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433852 ATCGAGACTGATGTGATTAAT pLKO_005 3360 CDS 100% 15.000 21.000 N Htr2b n/a
2 TRCN0000026313 CCGAGCCACAAAGTCAGTAAA pLKO.1 3974 CDS 100% 13.200 18.480 N Htr2b n/a
3 TRCN0000420481 CAATCATGTTTGAGGCTATAT pLKO_005 3118 CDS 100% 13.200 10.560 N Htr2b n/a
4 TRCN0000026285 GCGGTGATAATACCCACCATT pLKO.1 2964 CDS 100% 4.950 3.960 N Htr2b n/a
5 TRCN0000026246 GCCATCCCAGTCCCTATTAAA pLKO.1 3336 CDS 100% 15.000 10.500 N Htr2b n/a
6 TRCN0000026264 GCACAACTTCTGAGCACATTT pLKO.1 2812 CDS 100% 13.200 9.240 N Htr2b n/a
7 TRCN0000433020 GAGACACTTATGCGAAGAATG pLKO_005 3672 CDS 100% 10.800 7.560 N Htr2b n/a
8 TRCN0000026276 GCCTGGTTATTCCTCGATGTT pLKO.1 3165 CDS 100% 4.950 3.465 N Htr2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.