Transcript: Mouse XM_006529311.3

PREDICTED: Mus musculus histone deacetylase 4 (Hdac4), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hdac4 (208727)
Length:
8085
CDS:
215..3517

Additional Resources:

NCBI RefSeq record:
XM_006529311.3
NBCI Gene record:
Hdac4 (208727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039249 CCTCAGCAAGATAATCTCCAA pLKO.1 1774 CDS 100% 2.640 3.696 N Hdac4 n/a
2 TRCN0000039250 CATGGGTTTCTGCTACTTTAA pLKO.1 2689 CDS 100% 13.200 9.240 N Hdac4 n/a
3 TRCN0000380246 AGAAACTGGACAGTAAGAAAC pLKO_005 2454 CDS 100% 10.800 7.560 N HDAC4 n/a
4 TRCN0000039252 GAGGCACAGTTGCATGAACAT pLKO.1 566 CDS 100% 4.950 3.465 N Hdac4 n/a
5 TRCN0000039253 ACTCTCTGATTGAGGCGCAAA pLKO.1 3381 CDS 100% 4.050 2.835 N Hdac4 n/a
6 TRCN0000004831 GCAGCTCAAGAACAAGGAGAA pLKO.1 712 CDS 100% 4.050 2.835 N HDAC4 n/a
7 TRCN0000004832 GCCAAAGATGACTTCCCTCTT pLKO.1 956 CDS 100% 4.050 2.835 N HDAC4 n/a
8 TRCN0000314665 GCCAAAGATGACTTCCCTCTT pLKO_005 956 CDS 100% 4.050 2.835 N HDAC4 n/a
9 TRCN0000039251 GTTCTACATCAGAGACCCAAT pLKO.1 3272 CDS 100% 4.050 2.835 N Hdac4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.