Transcript: Mouse XM_006529472.4

PREDICTED: Mus musculus diacylglycerol kinase, delta (Dgkd), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dgkd (227333)
Length:
6274
CDS:
38..3613

Additional Resources:

NCBI RefSeq record:
XM_006529472.4
NBCI Gene record:
Dgkd (227333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079199 GCGAACACTTTACTATGCTAA pLKO.1 274 CDS 100% 4.950 6.930 N Dgkd n/a
2 TRCN0000079198 CCTCCCTGAATGGAAATAATT pLKO.1 5026 3UTR 100% 15.000 10.500 N Dgkd n/a
3 TRCN0000079200 CCGCCTTGTGACCAAGTTTAA pLKO.1 3406 CDS 100% 13.200 9.240 N Dgkd n/a
4 TRCN0000079201 CCTAGAATACTACACAGAGAA pLKO.1 2305 CDS 100% 4.950 3.465 N Dgkd n/a
5 TRCN0000079202 GCTACCCAGATGGATCAGTTT pLKO.1 2975 CDS 100% 4.950 3.465 N Dgkd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.