Transcript: Mouse XM_006529551.3

PREDICTED: Mus musculus pleckstrin homology domain containing, family A member 6 (Plekha6), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekha6 (240753)
Length:
7708
CDS:
396..3977

Additional Resources:

NCBI RefSeq record:
XM_006529551.3
NBCI Gene record:
Plekha6 (240753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426981 TCATCCCTGAACGGTACATTG pLKO_005 3604 CDS 100% 10.800 15.120 N PLEKHA6 n/a
2 TRCN0000182105 CGGAGGAGGAATGAGGAATTA pLKO.1 5116 3UTR 100% 13.200 9.240 N Plekha6 n/a
3 TRCN0000177814 CCTCCTTAAAGACTGGTAGAT pLKO.1 5677 3UTR 100% 4.950 3.465 N Plekha6 n/a
4 TRCN0000200370 GAGAGGATCAAGACGCTCATT pLKO.1 3684 CDS 100% 4.950 3.465 N Plekha6 n/a
5 TRCN0000200416 GAGCCTAGAAAGTGCCTTGAT pLKO.1 2354 CDS 100% 4.950 3.465 N Plekha6 n/a
6 TRCN0000182413 GCAGAGCAGAATCTTCCTCTA pLKO.1 5249 3UTR 100% 4.050 2.835 N Plekha6 n/a
7 TRCN0000200359 GCAGTGGAATAAGCGTTGGTT pLKO.1 620 CDS 100% 3.000 2.100 N Plekha6 n/a
8 TRCN0000177712 CCCTGACTATTACAATCCCTA pLKO.1 1496 CDS 100% 2.640 1.848 N Plekha6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.