Transcript: Mouse XM_006529651.2

PREDICTED: Mus musculus neurofascin (Nfasc), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nfasc (269116)
Length:
9600
CDS:
55..3870

Additional Resources:

NCBI RefSeq record:
XM_006529651.2
NBCI Gene record:
Nfasc (269116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094171 GCCAAGTTCGAGAACTTTAAT pLKO.1 1267 CDS 100% 1.500 2.100 N Nfasc n/a
2 TRCN0000094169 GCAACTGCAGACCTACCATAA pLKO.1 3927 3UTR 100% 10.800 8.640 N Nfasc n/a
3 TRCN0000094172 CGATGGTTTAAGAATGGGCAA pLKO.1 1780 CDS 100% 2.160 1.728 N Nfasc n/a
4 TRCN0000094170 CCTGAATCTAATCCCAGTGAT pLKO.1 2527 CDS 100% 4.950 3.465 N Nfasc n/a
5 TRCN0000094173 CCCTCGAGATAACATCCTGAT pLKO.1 504 CDS 100% 0.000 0.000 N Nfasc n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7309 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.