Transcript: Mouse XM_006529726.2

PREDICTED: Mus musculus ATPase, Ca++ transporting, plasma membrane 4 (Atp2b4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp2b4 (381290)
Length:
8467
CDS:
869..4450

Additional Resources:

NCBI RefSeq record:
XM_006529726.2
NBCI Gene record:
Atp2b4 (381290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101865 CCGGACTATCTGCTTAGCTTA pLKO.1 2740 CDS 100% 4.950 6.930 N Atp2b4 n/a
2 TRCN0000101867 CGAGATAATATGGTACGCAAT pLKO.1 2690 CDS 100% 4.050 5.670 N Atp2b4 n/a
3 TRCN0000101866 CCCAAGACTTTCTTAGAATTA pLKO.1 1136 CDS 100% 13.200 9.240 N Atp2b4 n/a
4 TRCN0000101869 GCAATCCTGAATTGGTTTCTA pLKO.1 4287 CDS 100% 5.625 3.938 N Atp2b4 n/a
5 TRCN0000151143 GAGGAAGAAGATGATGATGAA pLKO.1 1739 CDS 100% 4.950 2.475 Y SAMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.