Transcript: Mouse XM_006529773.3

PREDICTED: Mus musculus contactin associated protein-like 5A (Cntnap5a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cntnap5a (636808)
Length:
11202
CDS:
636..4553

Additional Resources:

NCBI RefSeq record:
XM_006529773.3
NBCI Gene record:
Cntnap5a (636808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255130 ACCTCCCGAATACAGATTTAT pLKO_005 2067 CDS 100% 15.000 12.000 N Cntnap5a n/a
2 TRCN0000255132 TCCCTACTCCATGACCTTAAA pLKO_005 2585 CDS 100% 13.200 10.560 N Cntnap5a n/a
3 TRCN0000255128 GCAATTGTGATGCAGATATAG pLKO_005 2842 CDS 100% 13.200 9.240 N Cntnap5a n/a
4 TRCN0000255131 TTTACTCTTGAATGGGCATAA pLKO_005 3434 CDS 100% 10.800 7.560 N Cntnap5a n/a
5 TRCN0000255129 AGCAATCCTGTGAGGTGTATA pLKO_005 2401 CDS 100% 13.200 7.920 N Cntnap5a n/a
6 TRCN0000119254 GCGACAAACTACAACTGTGAT pLKO.1 708 CDS 100% 4.950 2.970 N CNTNAP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.