Transcript: Mouse XM_006530165.2

PREDICTED: Mus musculus chemokine-like receptor 1 (Cmklr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cmklr1 (14747)
Length:
1678
CDS:
321..1436

Additional Resources:

NCBI RefSeq record:
XM_006530165.2
NBCI Gene record:
Cmklr1 (14747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027859 CGACTTCCTGTTCAACATCTT pLKO.1 566 CDS 100% 4.950 6.930 N Cmklr1 n/a
2 TRCN0000027923 GCCAACATTCATGGGAAGATA pLKO.1 855 CDS 100% 5.625 4.500 N Cmklr1 n/a
3 TRCN0000027931 CGTCTTTGAATGAGAAGGCTT pLKO.1 1384 CDS 100% 2.640 1.848 N Cmklr1 n/a
4 TRCN0000027892 CTTTGGCTACTTTGTGGACTT pLKO.1 377 CDS 100% 4.050 2.430 N Cmklr1 n/a
5 TRCN0000027890 GCAAGTAGTTTCCACAGGGTA pLKO.1 935 CDS 100% 2.640 1.584 N Cmklr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.