Transcript: Mouse XM_006530177.1

PREDICTED: Mus musculus musashi RNA-binding protein 1 (Msi1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msi1 (17690)
Length:
3095
CDS:
145..1200

Additional Resources:

NCBI RefSeq record:
XM_006530177.1
NBCI Gene record:
Msi1 (17690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064005 TGGATAAAGTGCTGGCGCAAT pLKO.1 365 CDS 100% 4.050 5.670 N MSI1 n/a
2 TRCN0000098553 CGGTGGAAGATGTGAAACACT pLKO.1 506 CDS 100% 3.000 4.200 N Msi1 n/a
3 TRCN0000287780 CGGTGGAAGATGTGAAACACT pLKO_005 506 CDS 100% 3.000 4.200 N Msi1 n/a
4 TRCN0000064003 GCGCGAATACTTCGGCCAGTT pLKO.1 252 CDS 100% 1.350 1.890 N MSI1 n/a
5 TRCN0000331330 GGTTTCGGCTTCGTCACTTTC pLKO_005 328 CDS 100% 10.800 7.560 N MSI1 n/a
6 TRCN0000295221 TTGCCACAGCCTTCACCAATG pLKO_005 1169 CDS 100% 6.000 4.200 N Msi1 n/a
7 TRCN0000098551 CCACTTCCATGAAATCAACAA pLKO.1 651 CDS 100% 4.950 3.465 N Msi1 n/a
8 TRCN0000287851 CCACTTCCATGAAATCAACAA pLKO_005 651 CDS 100% 4.950 3.465 N Msi1 n/a
9 TRCN0000098550 CCTGTTCAGACCTTGTCTCTT pLKO.1 1383 3UTR 100% 4.950 3.465 N Msi1 n/a
10 TRCN0000287850 CCTGTTCAGACCTTGTCTCTT pLKO_005 1383 3UTR 100% 4.950 3.465 N Msi1 n/a
11 TRCN0000098554 CGTAGAGAAAGTTTGTGAGAT pLKO.1 630 CDS 100% 4.950 3.465 N Msi1 n/a
12 TRCN0000098552 GAAACACTATTTCGAGCAGTT pLKO.1 519 CDS 100% 4.050 2.835 N Msi1 n/a
13 TRCN0000287852 GAAACACTATTTCGAGCAGTT pLKO_005 519 CDS 100% 4.050 2.835 N Msi1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.