Transcript: Mouse XM_006530287.3

PREDICTED: Mus musculus transmembrane protein 119 (Tmem119), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem119 (231633)
Length:
2145
CDS:
136..978

Additional Resources:

NCBI RefSeq record:
XM_006530287.3
NBCI Gene record:
Tmem119 (231633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530287.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247502 CCAAGTTCCAGCGCCCTTAAT pLKO_005 1157 3UTR 100% 13.200 18.480 N Tmem119 n/a
2 TRCN0000247505 AGCAACTGGTCCTCCTGAAAG pLKO_005 921 CDS 100% 10.800 8.640 N Tmem119 n/a
3 TRCN0000247501 CTGGAAGGGATCATGGATTTC pLKO_005 370 CDS 100% 10.800 7.560 N Tmem119 n/a
4 TRCN0000247504 ACCCATCCTCGTTCCCTGAAA pLKO_005 503 CDS 100% 4.950 3.465 N Tmem119 n/a
5 TRCN0000202367 GCAGAAGGGTCTTTCTCCTTA pLKO.1 883 CDS 100% 4.950 3.465 N Tmem119 n/a
6 TRCN0000190195 CATGGATTTCTTCCGGCAGTA pLKO.1 381 CDS 100% 4.050 2.835 N Tmem119 n/a
7 TRCN0000247503 CCTTCCTCATCATGTTCATAG pLKO_005 434 CDS 100% 10.800 6.480 N Tmem119 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530287.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.