Transcript: Mouse XM_006530580.3

PREDICTED: Mus musculus adenylate cyclase 7 (Adcy7), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adcy7 (11513)
Length:
3991
CDS:
421..3861

Additional Resources:

NCBI RefSeq record:
XM_006530580.3
NBCI Gene record:
Adcy7 (11513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374555 ACGCGTCCAGGGATCTCTTTA pLKO_005 1034 CDS 100% 13.200 18.480 N Adcy7 n/a
2 TRCN0000366126 TACTGACTGTCGCCATCATTA pLKO_005 2459 CDS 100% 13.200 18.480 N Adcy7 n/a
3 TRCN0000374616 GTGGGCTGATCAACGTCAAAG pLKO_005 3629 CDS 100% 10.800 15.120 N Adcy7 n/a
4 TRCN0000114900 GACTCGGATATTCGTGTGAAT pLKO.1 3605 CDS 100% 4.950 6.930 N Adcy7 n/a
5 TRCN0000366127 GACATCTGCGAGGCCATTAAG pLKO_005 1483 CDS 100% 13.200 10.560 N Adcy7 n/a
6 TRCN0000114897 GCCATCATTGAGCGCCTCAAA pLKO.1 1168 CDS 100% 4.950 3.960 N Adcy7 n/a
7 TRCN0000366125 TCGGAGTCTTGGTAGAATTTA pLKO_005 3359 CDS 100% 15.000 10.500 N Adcy7 n/a
8 TRCN0000114898 CCTGAAGATCATGGTTAACTT pLKO.1 2859 CDS 100% 5.625 3.938 N Adcy7 n/a
9 TRCN0000114899 GCACATCACAGAGGCAACATT pLKO.1 1668 CDS 100% 5.625 3.938 N Adcy7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.