Transcript: Mouse XM_006530714.3

PREDICTED: Mus musculus interleukin 15 (Il15), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Il15 (16168)
Length:
1582
CDS:
849..1292

Additional Resources:

NCBI RefSeq record:
XM_006530714.3
NBCI Gene record:
Il15 (16168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066670 CCAACTGGATAGATGTAAGAT pLKO.1 991 CDS 100% 5.625 4.500 N Il15 n/a
2 TRCN0000428385 GCCACTTGGATCACATGAAAT pLKO_005 1417 3UTR 100% 13.200 9.240 N Il15 n/a
3 TRCN0000066668 GCTTCCTAACAAGGAGATAAT pLKO.1 1394 3UTR 100% 13.200 9.240 N Il15 n/a
4 TRCN0000066671 GTACAGTAACATGACTCTTAA pLKO.1 1106 CDS 100% 13.200 9.240 N Il15 n/a
5 TRCN0000066672 GCTACTTGTGTTTCCTTCTAA pLKO.1 892 CDS 100% 5.625 3.938 N Il15 n/a
6 TRCN0000066669 GCTGGCATTCATGTCTTCATT pLKO.1 933 CDS 100% 5.625 3.938 N Il15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.