Transcript: Mouse XM_006530745.2

PREDICTED: Mus musculus lymphoblastomic leukemia 1 (Lyl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lyl1 (17095)
Length:
1736
CDS:
710..1327

Additional Resources:

NCBI RefSeq record:
XM_006530745.2
NBCI Gene record:
Lyl1 (17095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084527 GCACGCTCACAGCCCGTGCTT pLKO.1 1223 CDS 100% 0.000 0.000 N Lyl1 n/a
2 TRCN0000428855 GTTCAGTGAACTCCCTGTAAA pLKO_005 1354 3UTR 100% 13.200 9.240 N Lyl1 n/a
3 TRCN0000416534 TGCGCCTGGCCATGAAGTATA pLKO_005 1062 CDS 100% 13.200 9.240 N Lyl1 n/a
4 TRCN0000436401 TCCTCAACAGTGTCTACATTG pLKO_005 813 CDS 100% 10.800 7.560 N Lyl1 n/a
5 TRCN0000412981 AGGCTACTTGCAGTGGCTTTG pLKO_005 1472 3UTR 100% 6.000 4.200 N Lyl1 n/a
6 TRCN0000017539 CTTCCTCAACAGTGTCTACAT pLKO.1 811 CDS 100% 4.950 3.465 N LYL1 n/a
7 TRCN0000084525 CAGTGATAAACCTGGGACACA pLKO.1 669 5UTR 100% 2.640 1.848 N Lyl1 n/a
8 TRCN0000084526 CTTCCCTAACAGCCGGCTGAA pLKO.1 856 CDS 100% 1.350 0.945 N Lyl1 n/a
9 TRCN0000084524 CCATCAAGTTGGAGCAGACAT pLKO.1 1284 CDS 100% 4.950 3.465 N Lyl1 n/a
10 TRCN0000418493 GCCTGGCCATGAAGTATATCA pLKO_005 1065 CDS 100% 5.625 3.938 N TAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.