Transcript: Mouse XM_006530747.2

PREDICTED: Mus musculus mannosidase 2, alpha B1 (Man2b1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Man2b1 (17159)
Length:
3752
CDS:
600..3674

Additional Resources:

NCBI RefSeq record:
XM_006530747.2
NBCI Gene record:
Man2b1 (17159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018486 CGCATTGACTATCAAGATAAA pLKO.1 1290 CDS 100% 13.200 18.480 N Man2b1 n/a
2 TRCN0000340108 CGCATTGACTATCAAGATAAA pLKO_005 1290 CDS 100% 13.200 18.480 N Man2b1 n/a
3 TRCN0000018489 GCAAGGCAGAATGTTGTAAAT pLKO.1 1989 CDS 100% 13.200 18.480 N Man2b1 n/a
4 TRCN0000340037 GCAAGGCAGAATGTTGTAAAT pLKO_005 1989 CDS 100% 13.200 18.480 N Man2b1 n/a
5 TRCN0000018488 CGTCGCTTCATCTATGTGGAA pLKO.1 972 CDS 100% 2.640 3.696 N Man2b1 n/a
6 TRCN0000351107 CGTCGCTTCATCTATGTGGAA pLKO_005 972 CDS 100% 2.640 3.696 N Man2b1 n/a
7 TRCN0000018485 GCCTACATCTTCAGACCCAAT pLKO.1 2610 CDS 100% 4.050 2.835 N Man2b1 n/a
8 TRCN0000018487 GCTCTGAAAGAAGATTCGGAT pLKO.1 3399 CDS 100% 2.640 1.848 N Man2b1 n/a
9 TRCN0000340038 GCTCTGAAAGAAGATTCGGAT pLKO_005 3399 CDS 100% 2.640 1.848 N Man2b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.