Transcript: Mouse XM_006530779.3

PREDICTED: Mus musculus regulatory factor X, 1 (influences HLA class II expression) (Rfx1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rfx1 (19724)
Length:
4538
CDS:
252..3314

Additional Resources:

NCBI RefSeq record:
XM_006530779.3
NBCI Gene record:
Rfx1 (19724)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429872 TGCGGAACTGTTAACTTATTC pLKO_005 3845 3UTR 100% 13.200 18.480 N Rfx1 n/a
2 TRCN0000084506 CGTCATGGTAAACCTGCAGTT pLKO.1 2396 CDS 100% 4.050 5.670 N Rfx1 n/a
3 TRCN0000084505 GCAACTCTAAGTACCACTATT pLKO.1 2035 CDS 100% 13.200 9.240 N Rfx1 n/a
4 TRCN0000420753 TGGTATTAAGTGCAATTAAAG pLKO_005 3963 3UTR 100% 13.200 9.240 N Rfx1 n/a
5 TRCN0000420341 CAAGCTCATCCGCTCGGTATT pLKO_005 1979 CDS 100% 10.800 7.560 N Rfx1 n/a
6 TRCN0000084503 CCGATTTCTCAGTGTCTTCAA pLKO.1 4297 3UTR 100% 4.950 3.465 N Rfx1 n/a
7 TRCN0000084507 GCAGAACACTGCACAGATCAA pLKO.1 2828 CDS 100% 4.950 3.465 N Rfx1 n/a
8 TRCN0000358458 AGTACATGTACTACCTGATCG pLKO_005 3184 CDS 100% 4.050 2.835 N RFX1 n/a
9 TRCN0000014816 GCAGGCACCTACGTGATCCAA pLKO.1 1764 CDS 100% 1.000 0.700 N RFX1 n/a
10 TRCN0000014815 CCTCCTCAAGTGGTCCTTCTA pLKO.1 3080 CDS 100% 4.950 2.970 N RFX1 n/a
11 TRCN0000084504 GCACTGTGACAATGTGCTGTA pLKO.1 2576 CDS 100% 4.050 2.430 N Rfx1 n/a
12 TRCN0000136024 GATGAAGAAGAAGAGGAGGAA pLKO.1 3339 3UTR 100% 2.640 1.584 N GRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.