Transcript: Mouse XM_006530885.1

PREDICTED: Mus musculus carboxyesterase 2B (Ces2b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ces2b (234669)
Length:
3421
CDS:
114..1784

Additional Resources:

NCBI RefSeq record:
XM_006530885.1
NBCI Gene record:
Ces2b (234669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111013 CGATGAGTTTGGTTGGACCAT pLKO.1 1133 CDS 100% 2.640 3.696 N Ces2b n/a
2 TRCN0000111010 GCGTTACAAAGTCCATTTATT pLKO.1 1826 3UTR 100% 15.000 10.500 N Ces2b n/a
3 TRCN0000431376 GGCTGGATGTTCTCCTCTTTG pLKO_005 139 CDS 100% 10.800 7.560 N Ces2b n/a
4 TRCN0000111012 CATGGGCTCTGCTCAAACAAT pLKO.1 1163 CDS 100% 5.625 3.938 N Ces2b n/a
5 TRCN0000435051 AGGACTTGGTGGTGGTCACTA pLKO_005 607 CDS 100% 4.950 3.465 N Ces2b n/a
6 TRCN0000416706 TAACAAGCTTGTCCAGATGAT pLKO_005 1013 CDS 100% 4.950 3.465 N Ces2b n/a
7 TRCN0000111014 TGGATCTCTATTGGCAGCCAT pLKO.1 584 CDS 100% 2.640 1.848 N Ces2b n/a
8 TRCN0000111011 TCTGGGTGTAATGAAGGAGAT pLKO.1 413 CDS 100% 4.050 2.430 N Ces2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.