Transcript: Mouse XM_006530908.1

PREDICTED: Mus musculus zinc finger protein 612 (Zfp612), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp612 (234725)
Length:
5388
CDS:
609..2816

Additional Resources:

NCBI RefSeq record:
XM_006530908.1
NBCI Gene record:
Zfp612 (234725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084911 CCAGAGAATTAGCAGAGGCTT pLKO.1 1393 CDS 100% 2.640 3.696 N Zfp612 n/a
2 TRCN0000084912 CCACGTCAATGCTCACTTAAT pLKO.1 2591 CDS 100% 13.200 9.240 N Zfp612 n/a
3 TRCN0000084909 CGGGAAATGCTTTACTTCTAA pLKO.1 2327 CDS 100% 5.625 3.938 N Zfp612 n/a
4 TRCN0000084908 CCAAACTTAGTAAGAGTGAAA pLKO.1 1342 CDS 100% 4.950 3.465 N Zfp612 n/a
5 TRCN0000084910 CGTACATTACTCATCAGAGAA pLKO.1 1765 CDS 100% 4.950 3.465 N Zfp612 n/a
6 TRCN0000416554 AGTGTGCAGAATGTGGCAAAG pLKO_005 1474 CDS 100% 6.000 3.000 Y Zfp612 n/a
7 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1788 CDS 100% 6.000 3.000 Y Zfp612 n/a
8 TRCN0000413111 GCGAGTGTGGGAAAGCTTTCA pLKO_005 2404 CDS 100% 4.950 2.475 Y Zfp612 n/a
9 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1876 CDS 100% 5.625 2.813 Y ZNF625 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.