Transcript: Mouse XM_006530980.3

PREDICTED: Mus musculus ELMO/CED-12 domain containing 2 (Elmod2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elmod2 (244548)
Length:
860
CDS:
142..774

Additional Resources:

NCBI RefSeq record:
XM_006530980.3
NBCI Gene record:
Elmod2 (244548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247998 ACTGATCAATCTCGTGTATTT pLKO_005 660 CDS 100% 13.200 18.480 N Elmod2 n/a
2 TRCN0000217747 GACTGATCAATCTCGTGTATT pLKO.1 659 CDS 100% 13.200 18.480 N Elmod2 n/a
3 TRCN0000247996 CAGATTCTCTCCCGCTCAAAT pLKO_005 709 CDS 100% 13.200 10.560 N Elmod2 n/a
4 TRCN0000192419 CAGGTGTATAGCGAACATCAT pLKO.1 354 CDS 100% 4.950 3.960 N Elmod2 n/a
5 TRCN0000129933 GATGGCTTATAGCTTACTGAA pLKO.1 763 CDS 100% 4.950 3.960 N ELMOD2 n/a
6 TRCN0000247997 TGCAGATAACTGGCTATAAAC pLKO_005 440 CDS 100% 13.200 9.240 N Elmod2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.