Transcript: Mouse XM_006530991.3

PREDICTED: Mus musculus Rpgrip1-like (Rpgrip1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rpgrip1l (244585)
Length:
6742
CDS:
160..3966

Additional Resources:

NCBI RefSeq record:
XM_006530991.3
NBCI Gene record:
Rpgrip1l (244585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106079 CGGCTAGTTAATGACAAGAAA pLKO.1 409 CDS 100% 5.625 7.875 N Rpgrip1l n/a
2 TRCN0000106076 CGGGACAATGTAGAAACGATT pLKO.1 946 CDS 100% 4.950 6.930 N Rpgrip1l n/a
3 TRCN0000106077 CGGTGAAAGATACAGGTCTAA pLKO.1 197 CDS 100% 4.950 6.930 N Rpgrip1l n/a
4 TRCN0000062007 GCCACCAAGTTAATACGGCTA pLKO.1 394 CDS 100% 2.160 3.024 N RPGRIP1L n/a
5 TRCN0000106078 GCAGGAACTATCCAAGTTATA pLKO.1 2890 CDS 100% 13.200 10.560 N Rpgrip1l n/a
6 TRCN0000415673 ATAACCAGGGAGGATACTATT pLKO_005 3505 CDS 100% 13.200 9.240 N Rpgrip1l n/a
7 TRCN0000427563 GATCAAGCTATTCGACTTTAT pLKO_005 2389 CDS 100% 13.200 9.240 N Rpgrip1l n/a
8 TRCN0000256933 AGTGGGTCTACTATAACTATA pLKO_005 3608 CDS 100% 13.200 18.480 N RPGRIP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.