Transcript: Mouse XM_006531031.1

PREDICTED: Mus musculus acyl-CoA synthetase family member 3 (Acsf3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acsf3 (257633)
Length:
2182
CDS:
85..1836

Additional Resources:

NCBI RefSeq record:
XM_006531031.1
NBCI Gene record:
Acsf3 (257633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099196 GTTCCGAGAATACTGGGATAA pLKO.1 1374 CDS 100% 10.800 15.120 N Acsf3 n/a
2 TRCN0000156424 CATCATCAAGACTGGAGGCTA pLKO.1 1503 CDS 100% 2.640 2.112 N ACSF3 n/a
3 TRCN0000452937 ATCAAGACTGGAGGCTATAAA pLKO_005 1507 CDS 100% 15.000 10.500 N Acsf3 n/a
4 TRCN0000453510 CAGAAGACACCGAGGACATAG pLKO_005 153 CDS 100% 10.800 7.560 N Acsf3 n/a
5 TRCN0000099195 CCAGTCTCACAAGCACAGTAA pLKO.1 2036 3UTR 100% 4.950 3.465 N Acsf3 n/a
6 TRCN0000099198 GCTGTGGTTGCTCTTCAAGAA pLKO.1 1630 CDS 100% 4.950 3.465 N Acsf3 n/a
7 TRCN0000156574 GTGGACATCATCAAGACTGGA pLKO.1 1498 CDS 100% 2.640 1.848 N ACSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.