Transcript: Mouse XM_006531086.2

PREDICTED: Mus musculus NACHT and WD repeat domain containing 1 (Nwd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nwd1 (319555)
Length:
10495
CDS:
785..5506

Additional Resources:

NCBI RefSeq record:
XM_006531086.2
NBCI Gene record:
Nwd1 (319555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257630 ACAGGTGGTACACGTTCTAAT pLKO_005 3514 CDS 100% 13.200 10.560 N Nwd1 n/a
2 TRCN0000217309 GTGCTATCACCGATCAGTTAT pLKO.1 1267 CDS 100% 13.200 10.560 N Nwd1 n/a
3 TRCN0000257616 GTGCTATCACCGATCAGTTAT pLKO_005 1267 CDS 100% 13.200 10.560 N Nwd1 n/a
4 TRCN0000247062 TACGACTGTGCATGCTCTAAA pLKO_005 4934 CDS 100% 13.200 9.240 N Nwd1 n/a
5 TRCN0000257635 CAGGTAATCCAAGTTCGATAT pLKO_005 2798 CDS 100% 10.800 7.560 N Nwd1 n/a
6 TRCN0000178833 CCAGGTAATCCAAGTTCGATA pLKO.1 2797 CDS 100% 4.950 3.465 N Nwd1 n/a
7 TRCN0000179695 GCAAGGATCAACATGTGGAAT pLKO.1 3749 CDS 100% 4.950 3.465 N Nwd1 n/a
8 TRCN0000179877 CAGCTTTGTCTACTTCCCTAA pLKO.1 4486 CDS 100% 4.050 2.835 N Nwd1 n/a
9 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 7844 3UTR 100% 4.950 2.475 Y Gad2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8034 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.