Transcript: Mouse XM_006531165.2

PREDICTED: Mus musculus NLR family, CARD domain containing 5 (Nlrc5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlrc5 (434341)
Length:
7521
CDS:
671..6328

Additional Resources:

NCBI RefSeq record:
XM_006531165.2
NBCI Gene record:
Nlrc5 (434341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183912 CCAACGGACTTCTCAAGACTT pLKO.1 6334 3UTR 100% 4.950 3.465 N Nlrc5 n/a
2 TRCN0000183682 GCATTGACATTATGAGAGTAT pLKO.1 6570 3UTR 100% 4.950 3.465 N Nlrc5 n/a
3 TRCN0000183970 CTCAGAAGAACCTCTGTTGGT pLKO.1 6401 3UTR 100% 2.640 1.848 N Nlrc5 n/a
4 TRCN0000184561 GACTTATGAGTCCAGTCCAGT pLKO.1 6350 3UTR 100% 2.640 1.584 N Nlrc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.