Transcript: Mouse XM_006531191.3

PREDICTED: Mus musculus nuclear factor of activated T cells 5 (Nfat5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nfat5 (54446)
Length:
8804
CDS:
826..5481

Additional Resources:

NCBI RefSeq record:
XM_006531191.3
NBCI Gene record:
Nfat5 (54446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229557 TGCGGACAGTATCCGGTTAAA pLKO_005 1687 CDS 100% 13.200 18.480 N Nfat5 n/a
2 TRCN0000229558 CAATGATTCTGGTCGAGTAAA pLKO_005 1875 CDS 100% 13.200 10.560 N Nfat5 n/a
3 TRCN0000229559 TAGAGTAACTGGGCGAAATAC pLKO_005 1920 CDS 100% 13.200 10.560 N Nfat5 n/a
4 TRCN0000085644 GCAATGATTCTGGTCGAGTAA pLKO.1 1874 CDS 100% 4.950 3.960 N Nfat5 n/a
5 TRCN0000229560 TCCGTATCATGACCAACATAT pLKO_005 2406 CDS 100% 13.200 9.240 N Nfat5 n/a
6 TRCN0000020023 CGGACAACAAAGGCAACTCAA pLKO.1 1604 CDS 100% 4.950 3.465 N NFAT5 n/a
7 TRCN0000085646 GCAGAACAACATCCCTGGAAT pLKO.1 5088 CDS 100% 4.950 3.465 N Nfat5 n/a
8 TRCN0000085647 CCACCATGTTTCAGACACCAA pLKO.1 3803 CDS 100% 2.640 1.848 N Nfat5 n/a
9 TRCN0000085643 CCCAACATATTTCTTTCCCAA pLKO.1 4279 CDS 100% 2.640 1.848 N Nfat5 n/a
10 TRCN0000085645 GCGAAATACAACTCCCTGCAA pLKO.1 1932 CDS 100% 2.640 1.848 N Nfat5 n/a
11 TRCN0000218916 ACCATATTCCTGCTCGAATAT pLKO_005 8499 3UTR 100% 1.320 0.924 N Nfat5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.