Transcript: Mouse XM_006531198.3

PREDICTED: Mus musculus adhesion G protein-coupled receptor G3 (Adgrg3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrg3 (54672)
Length:
2867
CDS:
653..2134

Additional Resources:

NCBI RefSeq record:
XM_006531198.3
NBCI Gene record:
Adgrg3 (54672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004658 CGTGATCCTCACCTGTGTATT pLKO.1 1129 CDS 100% 13.200 18.480 N Adgrg3 n/a
2 TRCN0000431090 TGCCTGTTCTTGTAGTTATTG pLKO_005 1656 CDS 100% 13.200 10.560 N Adgrg3 n/a
3 TRCN0000428679 GCATGAATGTGCTGGATATAT pLKO_005 2424 3UTR 100% 15.000 10.500 N Adgrg3 n/a
4 TRCN0000004659 GCTGGAAGTAGCAACAGTTAT pLKO.1 1679 CDS 100% 13.200 9.240 N Adgrg3 n/a
5 TRCN0000004656 CCCAGCCAACAGTGTTATCTT pLKO.1 2579 3UTR 100% 5.625 3.938 N Adgrg3 n/a
6 TRCN0000004657 CCTGAATCTTACCTTCCTGAT pLKO.1 1444 CDS 100% 4.050 2.835 N Adgrg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.