Transcript: Mouse XM_006531265.3

PREDICTED: Mus musculus brain expressed, associated with Nedd4, 1 (Bean1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bean1 (65115)
Length:
3262
CDS:
454..1431

Additional Resources:

NCBI RefSeq record:
XM_006531265.3
NBCI Gene record:
Bean1 (65115)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531265.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263202 TGAGTGGCCAAGCTCATAAAT pLKO_005 1429 CDS 100% 15.000 21.000 N Bean1 n/a
2 TRCN0000263203 TACAACCGTACCAGCTATTTC pLKO_005 586 CDS 100% 13.200 18.480 N Bean1 n/a
3 TRCN0000263199 ATCTCCATCGAAGACTATATA pLKO_005 2582 3UTR 100% 15.000 10.500 N Bean1 n/a
4 TRCN0000263200 ACTGACCTTCACGAGTCTTTG pLKO_005 918 CDS 100% 10.800 7.560 N Bean1 n/a
5 TRCN0000263201 AGGATTACATGTCCTTCAAAC pLKO_005 548 CDS 100% 10.800 7.560 N Bean1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531265.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.