Transcript: Mouse XM_006531442.3

PREDICTED: Mus musculus mixed lineage kinase domain-like (Mlkl), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mlkl (74568)
Length:
2312
CDS:
124..1542

Additional Resources:

NCBI RefSeq record:
XM_006531442.3
NBCI Gene record:
Mlkl (74568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360818 AGATCCAGTTCAACGATATAT pLKO_005 1192 CDS 100% 15.000 21.000 N Mlkl n/a
2 TRCN0000360819 AGCCGGAGGCTACCAAGTAAA pLKO_005 1101 CDS 100% 13.200 18.480 N Mlkl n/a
3 TRCN0000022602 CGGACAGCAAAGAGCACTAAA pLKO.1 1165 CDS 100% 13.200 18.480 N Mlkl n/a
4 TRCN0000022603 CATTGGAATACCGTTTCAGAT pLKO.1 478 CDS 100% 4.950 6.930 N Mlkl n/a
5 TRCN0000003225 GCGTATATTTGGGATTTGCAT pLKO.1 879 CDS 100% 3.000 4.200 N MLKL n/a
6 TRCN0000360745 TCCCAACATCTTGCGTATATT pLKO_005 867 CDS 100% 15.000 10.500 N Mlkl n/a
7 TRCN0000022600 CCTGAAGCAATGCTCACTAAA pLKO.1 618 CDS 100% 13.200 9.240 N Mlkl n/a
8 TRCN0000022599 GCAGGATTTGAGTTAAGCAAA pLKO.1 1126 CDS 100% 4.950 3.465 N Mlkl n/a
9 TRCN0000022601 CCCTGAGTTCTCCATTGTCAT pLKO.1 918 CDS 100% 4.950 2.970 N Mlkl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.