Transcript: Mouse XM_006531503.2

PREDICTED: Mus musculus nucleolar protein 3 (apoptosis repressor with CARD domain) (Nol3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nol3 (78688)
Length:
1496
CDS:
672..1334

Additional Resources:

NCBI RefSeq record:
XM_006531503.2
NBCI Gene record:
Nol3 (78688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086917 CAAGAAATGAATCCAGAACAA pLKO.1 1176 CDS 100% 4.950 3.465 N Nol3 n/a
2 TRCN0000086914 GAGCCAGAACTAGAAGCTGAA pLKO.1 1125 CDS 100% 4.050 2.835 N Nol3 n/a
3 TRCN0000086915 CCCGACTTCCAAGAAGAGGAT pLKO.1 1296 CDS 100% 2.640 1.848 N Nol3 n/a
4 TRCN0000086916 CCCGAGTACGAAGCCTTGGAT pLKO.1 798 CDS 100% 1.000 0.700 N Nol3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.