Transcript: Mouse XM_006531506.2

PREDICTED: Mus musculus spermatogenesis associated 2-like (Spata2l), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata2l (78779)
Length:
2059
CDS:
66..1046

Additional Resources:

NCBI RefSeq record:
XM_006531506.2
NBCI Gene record:
Spata2l (78779)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106349 CCCGACTCATTCACTGCGCAT pLKO.1 938 CDS 100% 0.720 1.008 N Spata2l n/a
2 TRCN0000414552 GGAACCGCCAGCTGATGATAT pLKO_005 596 CDS 100% 13.200 9.240 N Spata2l n/a
3 TRCN0000428473 GAAAGAGCAGAGCTTACTTAG pLKO_005 1496 3UTR 100% 10.800 7.560 N Spata2l n/a
4 TRCN0000419018 TGAGTCGCTCAGGAGACTTAG pLKO_005 709 CDS 100% 10.800 7.560 N Spata2l n/a
5 TRCN0000437932 GTTGGAGTGTGAGATCCTAAG pLKO_005 242 CDS 100% 6.000 4.200 N Spata2l n/a
6 TRCN0000106345 GCAGCTAACCAGGAAGAAGTT pLKO.1 1720 3UTR 100% 4.950 3.465 N Spata2l n/a
7 TRCN0000106346 CAGGTGGATAACCTGCTCTAT pLKO.1 1002 CDS 100% 0.495 0.347 N Spata2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.