Transcript: Mouse XM_006531683.3

PREDICTED: Mus musculus polymerase (DNA directed), alpha 2 (Pola2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pola2 (18969)
Length:
2528
CDS:
401..2212

Additional Resources:

NCBI RefSeq record:
XM_006531683.3
NBCI Gene record:
Pola2 (18969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531683.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375269 CCCTGCAGCCTCTCCATAAAT pLKO_005 1784 CDS 100% 15.000 21.000 N Pola2 n/a
2 TRCN0000366404 CAGCGCAAGAGCCTGTTATTC pLKO_005 1017 CDS 100% 13.200 18.480 N Pola2 n/a
3 TRCN0000366472 CGTCCGAGCTGAGATACTTTG pLKO_005 2031 CDS 100% 10.800 15.120 N Pola2 n/a
4 TRCN0000366470 TGAACAGCAAGTCCGTGATTC pLKO_005 1074 CDS 100% 10.800 15.120 N Pola2 n/a
5 TRCN0000120323 CCGTTCTATCAGCCTACTGAA pLKO.1 1256 CDS 100% 4.950 6.930 N Pola2 n/a
6 TRCN0000120325 CTCTTATACCACACCCTCTAA pLKO.1 613 CDS 100% 4.950 3.960 N Pola2 n/a
7 TRCN0000366471 CTTCCCTGGACAGGTTGTAAT pLKO_005 1168 CDS 100% 13.200 9.240 N Pola2 n/a
8 TRCN0000120322 GCGTGGCTCTGATCTGAATTA pLKO.1 2374 3UTR 100% 13.200 9.240 N Pola2 n/a
9 TRCN0000375204 TAGACTACGAGAACTTCTATA pLKO_005 1968 CDS 100% 13.200 9.240 N Pola2 n/a
10 TRCN0000375268 GCAGCTACAAAGCGATGTTTC pLKO_005 891 CDS 100% 10.800 7.560 N Pola2 n/a
11 TRCN0000120326 CGAGCTGAGATACTTTGTGAA pLKO.1 2035 CDS 100% 4.950 3.465 N Pola2 n/a
12 TRCN0000120324 GCTCTTATACCACACCCTCTA pLKO.1 612 CDS 100% 4.050 2.835 N Pola2 n/a
13 TRCN0000366403 TGGCCAAACTGTTGGAGTACC pLKO_005 2271 3UTR 100% 4.050 2.835 N Pola2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531683.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.