Transcript: Mouse XM_006531721.3

PREDICTED: Mus musculus neuronal PAS domain protein 4 (Npas4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npas4 (225872)
Length:
4968
CDS:
1845..4253

Additional Resources:

NCBI RefSeq record:
XM_006531721.3
NBCI Gene record:
Npas4 (225872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531721.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095548 CGACAGTATCTACGATATCAT pLKO.1 2192 CDS 100% 5.625 7.875 N Npas4 n/a
2 TRCN0000095544 CGTCTTCAAGTATGGCATATT pLKO.1 4271 3UTR 100% 13.200 10.560 N Npas4 n/a
3 TRCN0000424907 ATGGATTTCAAGCGGAGAATG pLKO_005 4503 3UTR 100% 10.800 8.640 N Npas4 n/a
4 TRCN0000095545 CGTTTCTGAAAGTGTCCTAAT pLKO.1 2537 CDS 100% 10.800 8.640 N Npas4 n/a
5 TRCN0000422934 ACCTGGATTTCTCCTTGTATT pLKO_005 2087 CDS 100% 13.200 9.240 N Npas4 n/a
6 TRCN0000415807 GAGCGATCCCAGTTTCCATTT pLKO_005 4449 3UTR 100% 10.800 7.560 N NPAS4 n/a
7 TRCN0000095546 CCTGATAATTTATTCCTGGAA pLKO.1 3942 CDS 100% 2.640 1.848 N Npas4 n/a
8 TRCN0000095547 CCTGGATCTTAAACCCTGGAA pLKO.1 3893 CDS 100% 2.640 1.584 N Npas4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531721.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.