Transcript: Mouse XM_006531879.3

PREDICTED: Mus musculus CD300 molecule like family member D4 (Cd300ld4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd300ld4 (100043123)
Length:
866
CDS:
134..772

Additional Resources:

NCBI RefSeq record:
XM_006531879.3
NBCI Gene record:
Cd300ld4 (100043123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281915 GGAACTGATCCCATGTTTAAA pLKO_005 473 CDS 100% 15.000 7.500 Y Cd300ld5 n/a
2 TRCN0000281856 ACTGGTGCCGAGGAGCTTATT pLKO_005 288 CDS 100% 13.200 6.600 Y Cd300ld4 n/a
3 TRCN0000281914 ATGAGCGATGCTGACATTTAC pLKO_005 431 CDS 100% 13.200 6.600 Y Cd300ld4 n/a
4 TRCN0000100059 CGTGAACATTGACCCAGAAAT pLKO.1 499 CDS 100% 13.200 6.600 Y Cd300ld3 n/a
5 TRCN0000297093 GAACATTGACCCAGAAATTTC pLKO_005 502 CDS 100% 13.200 6.600 Y Cd300ld4 n/a
6 TRCN0000434571 GATGAGCGATGCTGACATTTA pLKO_005 430 CDS 100% 13.200 6.600 Y Cd300ld3 n/a
7 TRCN0000284629 GGATGAGCGATGCTGACATTT pLKO_005 429 CDS 100% 13.200 6.600 Y Cd300ld5 n/a
8 TRCN0000272148 TTGACAGTGCAGTGCAGATAT pLKO_005 239 CDS 100% 13.200 6.600 Y Cd300ld5 n/a
9 TRCN0000436510 ACAGGCCTCAGAGACACTATG pLKO_005 742 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
10 TRCN0000272146 ATGTGAGATTCTCGTTGAAAC pLKO_005 316 CDS 100% 10.800 5.400 Y Cd300ld4 n/a
11 TRCN0000281916 CCAGAAATTTCAACTACAATC pLKO_005 512 CDS 100% 10.800 5.400 Y Cd300ld5 n/a
12 TRCN0000439865 CCTTCTTGCTGATGGTCTTTG pLKO_005 673 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
13 TRCN0000443275 GCATTGGCACAGAGAACATTG pLKO_005 627 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
14 TRCN0000100056 GCCGAGGAGCTTATTGGAAAT pLKO.1 294 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
15 TRCN0000281858 TACTGGTGCCGAGGAGCTTAT pLKO_005 287 CDS 100% 10.800 5.400 Y Cd300ld5 n/a
16 TRCN0000438034 TGACAGTGCAGTGCAGATATG pLKO_005 240 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
17 TRCN0000100058 CATGTGAGATTCTCGTTGAAA pLKO.1 315 CDS 100% 5.625 2.813 Y Cd300ld3 n/a
18 TRCN0000100055 CCCAGAAATTTCAACTACAAT pLKO.1 511 CDS 100% 5.625 2.813 Y Cd300ld3 n/a
19 TRCN0000100057 GCTGGAACTGATCCCATGTTT pLKO.1 470 CDS 100% 5.625 2.813 Y Cd300ld3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.