Transcript: Mouse XM_006532026.1

PREDICTED: Mus musculus aldehyde dehydrogenase family 3, subfamily A1 (Aldh3a1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aldh3a1 (11670)
Length:
1609
CDS:
58..1419

Additional Resources:

NCBI RefSeq record:
XM_006532026.1
NBCI Gene record:
Aldh3a1 (11670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438676 CACTTCCAGCGGGTCATAAAT pLKO_005 925 CDS 100% 15.000 21.000 N Aldh3a1 n/a
2 TRCN0000417938 AGCTTGGATGAGGCCATTAAA pLKO_005 1096 CDS 100% 15.000 10.500 N Aldh3a1 n/a
3 TRCN0000042079 CCCTCCATTCAGAATGAAATT pLKO.1 817 CDS 100% 13.200 9.240 N Aldh3a1 n/a
4 TRCN0000425487 GGTGCTTGGAACTACCCATTC pLKO_005 391 CDS 100% 6.000 4.200 N Aldh3a1 n/a
5 TRCN0000042081 GCGGAATGAAGAAGCTAACAA pLKO.1 1356 CDS 100% 5.625 3.938 N Aldh3a1 n/a
6 TRCN0000042078 GCTGTCCTGTCCTTGAAGAAT pLKO.1 1452 3UTR 100% 5.625 3.938 N Aldh3a1 n/a
7 TRCN0000042082 GCGCATGATCAACGAGAACTT pLKO.1 159 CDS 100% 4.950 3.465 N Aldh3a1 n/a
8 TRCN0000042080 CCTCAGTATATGGACAAGGAT pLKO.1 520 CDS 100% 3.000 2.100 N Aldh3a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.