Transcript: Mouse XM_006532027.3

PREDICTED: Mus musculus aldehyde dehydrogenase family 3, subfamily A1 (Aldh3a1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aldh3a1 (11670)
Length:
1755
CDS:
204..1565

Additional Resources:

NCBI RefSeq record:
XM_006532027.3
NBCI Gene record:
Aldh3a1 (11670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438676 CACTTCCAGCGGGTCATAAAT pLKO_005 1071 CDS 100% 15.000 21.000 N Aldh3a1 n/a
2 TRCN0000417938 AGCTTGGATGAGGCCATTAAA pLKO_005 1242 CDS 100% 15.000 10.500 N Aldh3a1 n/a
3 TRCN0000042079 CCCTCCATTCAGAATGAAATT pLKO.1 963 CDS 100% 13.200 9.240 N Aldh3a1 n/a
4 TRCN0000425487 GGTGCTTGGAACTACCCATTC pLKO_005 537 CDS 100% 6.000 4.200 N Aldh3a1 n/a
5 TRCN0000042081 GCGGAATGAAGAAGCTAACAA pLKO.1 1502 CDS 100% 5.625 3.938 N Aldh3a1 n/a
6 TRCN0000042078 GCTGTCCTGTCCTTGAAGAAT pLKO.1 1598 3UTR 100% 5.625 3.938 N Aldh3a1 n/a
7 TRCN0000042082 GCGCATGATCAACGAGAACTT pLKO.1 305 CDS 100% 4.950 3.465 N Aldh3a1 n/a
8 TRCN0000042080 CCTCAGTATATGGACAAGGAT pLKO.1 666 CDS 100% 3.000 2.100 N Aldh3a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.