Transcript: Mouse XM_006532195.3

PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 (Gabra1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gabra1 (14394)
Length:
4227
CDS:
26..1687

Additional Resources:

NCBI RefSeq record:
XM_006532195.3
NBCI Gene record:
Gabra1 (14394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009910 CCGTTCAGTGGTTGTAGCAGA pLKO.1 925 CDS 100% 2.640 3.696 N Gabra1 n/a
2 TRCN0000009909 TGCCTAATAAGCTCCTGCGTA pLKO.1 738 CDS 100% 2.640 3.696 N Gabra1 n/a
3 TRCN0000436272 GTCTATTGGGCCACGTATTTA pLKO_005 1625 CDS 100% 15.000 12.000 N Gabra1 n/a
4 TRCN0000424202 AGGTTTGGGAGAGCGTGTAAC pLKO_005 493 CDS 100% 10.800 8.640 N Gabra1 n/a
5 TRCN0000009908 GACCAGTTTCAGACCACGATA pLKO.1 549 CDS 100% 4.950 3.960 N Gabra1 n/a
6 TRCN0000009911 GACGACTGTTCTGACTATGAC pLKO.1 1177 CDS 100% 4.950 3.465 N Gabra1 n/a
7 TRCN0000061151 CCGACTGTCAAGAATAGCCTT pLKO.1 1576 CDS 100% 2.640 1.848 N GABRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.