Transcript: Mouse XM_006532372.3

PREDICTED: Mus musculus caspase recruitment domain family, member 14 (Card14), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Card14 (170720)
Length:
4253
CDS:
530..3619

Additional Resources:

NCBI RefSeq record:
XM_006532372.3
NBCI Gene record:
Card14 (170720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243894 GATCAACACTGAAGGTTATAA pLKO_005 2506 CDS 100% 15.000 21.000 N Card14 n/a
2 TRCN0000361973 CACAGAAGTTAGTACGAATTG pLKO_005 2904 CDS 100% 10.800 15.120 N Card14 n/a
3 TRCN0000243892 AGAAGAACTAAATCGGCTTAA pLKO_005 1312 CDS 100% 10.800 8.640 N Card14 n/a
4 TRCN0000243893 GATCATGATGGTGGACTATAA pLKO_005 2383 CDS 100% 13.200 9.240 N Card14 n/a
5 TRCN0000243891 GTGCTGTTTGTGCCTAGATTA pLKO_005 3095 CDS 100% 13.200 9.240 N Card14 n/a
6 TRCN0000361972 TAAGGGCCACTCTGGAGAATA pLKO_005 2421 CDS 100% 13.200 9.240 N Card14 n/a
7 TRCN0000362029 TGTGGAGTCCCTCATGAATAT pLKO_005 3277 CDS 100% 13.200 9.240 N Card14 n/a
8 TRCN0000243890 CAGGTGGACTGTGAACTATAC pLKO_005 1538 CDS 100% 10.800 7.560 N Card14 n/a
9 TRCN0000176413 CCACAGACATCTGCAAATGAA pLKO.1 4017 3UTR 100% 5.625 3.938 N Card14 n/a
10 TRCN0000175693 GAACTGCAAACTCACTGCAAT pLKO.1 2621 CDS 100% 4.950 3.465 N Card14 n/a
11 TRCN0000173351 GCTGGAACAGATTGGTGTCAT pLKO.1 2278 CDS 100% 4.950 2.970 N Card14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.