Transcript: Mouse XM_006532406.4

PREDICTED: Mus musculus mannose receptor, C type 2 (Mrc2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mrc2 (17534)
Length:
6352
CDS:
590..5131

Additional Resources:

NCBI RefSeq record:
XM_006532406.4
NBCI Gene record:
Mrc2 (17534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123928 GTGGACAGATGGTTCTATTAT pLKO.1 3394 CDS 100% 15.000 10.500 N Mrc2 n/a
2 TRCN0000123924 GCCGACATGATGACGATGATA pLKO.1 3015 CDS 100% 5.625 3.938 N Mrc2 n/a
3 TRCN0000437854 CACGAGCAGACCTACATCAAC pLKO_005 1529 CDS 100% 4.950 3.465 N MRC2 n/a
4 TRCN0000123927 CCAGTTCCTCAATAAGTGTTT pLKO.1 3622 CDS 100% 4.950 3.465 N Mrc2 n/a
5 TRCN0000123925 GCCTGATGTCTTCCTCATCTT pLKO.1 811 CDS 100% 4.950 3.465 N Mrc2 n/a
6 TRCN0000123926 GCAAGAAGAAACCCAACGCTA pLKO.1 1767 CDS 100% 2.640 1.848 N Mrc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.